AllenCell · meganrm · Jul 31, 2026
diff --git a/src/pages/cell-line/AICS-84-18/index.md b/src/pages/cell-line/AICS-84-18/index.md
@@ -2,6 +2,7 @@
 templateKey: cell-line
 cell_line_id: 84
 status: data complete
+date: 2026-07-30T22:29:00.000Z
 clone_number: 18
 parental_line: 0
 genetic_modifications:
@@ -16,77 +17,105 @@ genetic_modifications:
 order_link: https://www.coriell.org/0/Sections/Search/Sample_Detail.aspx?Ref=AICS-0084-018&PgId=166
 certificate_of_analysis: https://www.coriell.org/0/PDF/Allen/ipsc/AICS-0084-018_CofA.pdf
 donor_plasmid: https://www.addgene.org/The_Allen_Institute_for_Cell_Science/
-hpscreg_certificate_link: https://hpscreg.eu/cell-line/UCSFi001-A-38
 images_and_videos:
   images:
     - image: single_plane_image_cl18.jpg
-      caption: "Single mid-level plane of live hiPS cell colony expressing mEGFP-tagged nucleophosmin. Right panel is the same image as the left but with contrast enhanced to visualize dimmer localization in mitotic cells. Images are maximum intensity projections through the volume of the cells. Cells were imaged in 3D on a spinning-disk confocal microscope. Scale bar, 5µm. "
+      caption: "Single mid-level plane of live hiPS cell colony expressing
+        mEGFP-tagged nucleophosmin. Right panel is the same image as the left
+        but with contrast enhanced to visualize dimmer localization in mitotic
+        cells. Images are maximum intensity projections through the volume of
+        the cells. Cells were imaged in 3D on a spinning-disk confocal
+        microscope. Scale bar, 5µm. "
     - image: Main_cell_line_morphology.jpg
-      caption: "Viability and colony formation photographed 3 days post-thaw at 4X magnification. Cells were treated with ROCK inhibitor for 24 hrs post-thaw."
+      caption: Viability and colony formation photographed 3 days post-thaw at 4X
+        magnification. Cells were treated with ROCK inhibitor for 24 hrs
+        post-thaw.
+    - image: Western blot documentation FBL_NPM1 final clone
+        only_final_20190306_edited_20190416_final.jpg
+    - image: FBL_NPM1_clone18_andAICS0_20190319_v2.jpg
   videos:
     - video: https://player.vimeo.com/video/333852568
-      caption: "Z-stack of live hiPS cell colony expressing mEGFP-tagged fibrillarin and mTagRFP-T-tagged nucleophosmin. Panels show individual channels for fibrillarin (left) and nucleophosmin (middle) and the overlay of the two (right). Cells were imaged in 3D on a spinning-disk confocal microscope. Movie starts at the bottom of the cells and ends at the top. Scale bar, 5µm."
+      caption: Z-stack of live hiPS cell colony expressing mEGFP-tagged fibrillarin
+        and mTagRFP-T-tagged nucleophosmin. Panels show individual channels for
+        fibrillarin (left) and nucleophosmin (middle) and the overlay of the two
+        (right). Cells were imaged in 3D on a spinning-disk confocal microscope.
+        Movie starts at the bottom of the cells and ends at the top. Scale bar,
+        5µm.
     - video: https://player.vimeo.com/video/333852580
-      caption: "Time-lapse movie of live hiPS cell colony expressing mEGFP-tagged fibrillarin and mTagRFP-T-tagged nucleophosmin. The region bounded by a dashed line is shown at the same scale with enhanced contrast to highlight changes in localization during mitosis. A single, mid-level plane of the cells was imaged every 3 min on a spinning-disk confocal microscope. Movie plays at 900x real time. Scale bar, 5 µm."
+      caption: Time-lapse movie of live hiPS cell colony expressing mEGFP-tagged
+        fibrillarin and mTagRFP-T-tagged nucleophosmin. The region bounded by a
+        dashed line is shown at the same scale with enhanced contrast to
+        highlight changes in localization during mitosis. A single, mid-level
+        plane of the cells was imaged every 3 min on a spinning-disk confocal
+        microscope. Movie plays at 900x real time. Scale bar, 5 µm.
     - video: https://player.vimeo.com/video/333852631
-      caption: "Time-lapse movie of live hiPS cell colony expressing mEGFP-tagged fibrillarin and mTagRFP-T-tagged nucleophosmin. Panels show individual channels for fibrillarin (left) and nucleophosmin (middle) and the overlay of the two (right). Cells were imaged in 3D on a spinning-disk confocal microscope every 3 min. Frames are maximum intensity z-projections through the entire volume of the cell. Movie plays at 1800x real time. Scale bar, 20 µm."
+      caption: Time-lapse movie of live hiPS cell colony expressing mEGFP-tagged
+        fibrillarin and mTagRFP-T-tagged nucleophosmin. Panels show individual
+        channels for fibrillarin (left) and nucleophosmin (middle) and the
+        overlay of the two (right). Cells were imaged in 3D on a spinning-disk
+        confocal microscope every 3 min. Frames are maximum intensity
+        z-projections through the entire volume of the cell. Movie plays at
+        1800x real time. Scale bar, 20 µm.
 editing_design:
   ncbi_isoforms:
     - n
   cr_rna: AACTGAAGTTCAGCGCTGTC / TCCAGGCTATTCAAGATCTC
   linker: KPNSAVDGTAGPGSIAT / KPNSAVDGTAGPGSIAT
   cas9: Wildtype spCas9
   diagrams:
-    - title: "mEGFP Insert"
+    - title: mEGFP Insert
       images:
         - image: EditingDesign_gene_figure.png
-          caption: "Top: FBL locus with zoom in on mEGFP insertion site at FBL C-terminal exon. Bottom: NPM1 locus showing 7 NPM1 isoforms with zoom in on mTagRFP-T insertion site at NPM1 C-terminal exon"
-category_labels: 
-  - Key Structure and Organelle
-  - Nuclear Structure
+          caption: "Top: FBL locus with zoom in on mEGFP insertion site at FBL C-terminal
+            exon. Bottom: NPM1 locus showing 7 NPM1 isoforms with zoom in on
+            mTagRFP-T insertion site at NPM1 C-terminal exon"
 genomic_characterization:
   diagrams:
-    - title: "Schematic of Junctions"
+    - title: Schematic of Junctions
       images:
         - image: /img/shared/GenomicCharacterization_junction_schematic_generic.png
-    - title: "Karyotype Analysis"
+    - title: Karyotype Analysis
       images:
         - image: FBL_NPM1_cl18_final_karyo.JPG
-          caption: "After cells banks were created, one vial was thawed and 30 G-banded metaphase cells were karyotyped."
+          caption: After cells banks were created, one vial was thawed and 30 G-banded
+            metaphase cells were karyotyped.
   amplified_junctions:
-    - edited_gene: "FBL-mEGFP"
-      junction: "5'"
+    - edited_gene: FBL-mEGFP
+      junction: 5'
       expected_size: "1560"
-      confirmed_sequence: "Yes"
-    - edited_gene: "FBL-mEGFP"
-      junction: "3'"
+      confirmed_sequence: Yes
+    - edited_gene: FBL-mEGFP
+      junction: 3'
       expected_size: "1754"
-      confirmed_sequence: "Yes"
-    - edited_gene: "FBL-mEGFP"
-      junction: "WT internal"
+      confirmed_sequence: Yes
+    - edited_gene: FBL-mEGFP
+      junction: WT internal
       expected_size: "671"
-      confirmed_sequence: "Yes"
-    - edited_gene: "FBL-mEGFP"
-      junction: "Full junctional allele"
-      expected_size: "Tagged:2925; Untagged:2169"
+      confirmed_sequence: Yes
+    - edited_gene: FBL-mEGFP
+      junction: Full junctional allele
+      expected_size: Tagged:2925; Untagged:2169
       confirmed_sequence: ""
-    - edited_gene: "NPM1-mTagRFP-T"
-      junction: "5'"
+    - edited_gene: NPM1-mTagRFP-T
+      junction: 5'
       expected_size: "1560"
-      confirmed_sequence: "Yes"
-    - edited_gene: "NPM1-mTagRFP-T"
-      junction: "3'"
+      confirmed_sequence: Yes
+    - edited_gene: NPM1-mTagRFP-T
+      junction: 3'
       expected_size: "1657"
-      confirmed_sequence: "Yes"
-    - edited_gene: "NPM1-mTagRFP-T"
-      junction: "WT internal"
+      confirmed_sequence: Yes
+    - edited_gene: NPM1-mTagRFP-T
+      junction: WT internal
       expected_size: "1179"
-      confirmed_sequence: "Yes"
-    - edited_gene: "NPM1-mTagRFP-T"
-      junction: "Full junctional allele"
-      expected_size: "Tagged:WIP; Untagged:WIP"
+      confirmed_sequence: Yes
+    - edited_gene: NPM1-mTagRFP-T
+      junction: Full junctional allele
+      expected_size: Tagged:WIP; Untagged:WIP
       confirmed_sequence: ""
-  junction_table_caption: "PCR amplified 5', 3', WT, and full allele junctions. 5', 3', and WT junctions were Sanger sequenced to check for precise mEGFP insertion. Primers were designed to exclude amplification from the donor plasmid."
+  junction_table_caption: PCR amplified 5', 3', WT, and full allele junctions. 5',
+    3', and WT junctions were Sanger sequenced to check for precise mEGFP
+    insertion. Primers were designed to exclude amplification from the donor
+    plasmid.
   ddpcr:
     - tag: FBL-mEGFP
       clone: 18
@@ -96,36 +125,56 @@ genomic_characterization:
       clone: 18
       fp_ratio: 0.526
       plasmid: 0.042
-  ddpcr_caption: "FP:RPP30 ratio from ddPCR assay; values = 0.5 +/- 0.1 indicate heterozygous clone, values = 1 +/- 0.1 indicate homozygous clone. Plasmid: AmpR/RPP30 ratio from ddPCR assay; values <0.1 indicate clone with no detectable plasmid integration. RPP30 is known 2n reference gene."
+  ddpcr_caption: "FP:RPP30 ratio from ddPCR assay; values = 0.5 +/- 0.1 indicate
+    heterozygous clone, values = 1 +/- 0.1 indicate homozygous clone. Plasmid:
+    AmpR/RPP30 ratio from ddPCR assay; values <0.1 indicate clone with no
+    detectable plasmid integration. RPP30 is known 2n reference gene."
+category_labels:
+  - Key Structure and Organelle
+  - Nuclear Structure
+hpscreg_certificate_link: https://hpscreg.eu/cell-line/UCSFi001-A-38
 stem_cell_characteristics:
   pluripotency_analysis:
-    - marker: "NANOG"
+    - marker: NANOG
       positive_cells: 99.8
-    - marker: "SOX2"
+    - marker: SOX2
       positive_cells: 99.9
-    - marker: "OCT4"
+    - marker: OCT4
       positive_cells: 99.8
-    - marker: "SSEA-1"
+    - marker: SSEA-1
       positive_cells: 0.63
-    - marker: "SSEA-4"
+    - marker: SSEA-4
       positive_cells: 100
-    - marker: "TRA-160"
+    - marker: TRA-160
       positive_cells: 99.8
-  pluripotency_caption: "iPSCs were stained with directly conjugated antibodies from BD Biosciences, acquired using a FACSAria III Fusion (BD Biosciences), and analyzed using FlowJo software (Treestar, Inc.). Doublets were excluded, then marker-specific gates were set according to corresponding fluorescence-minus-one (FMO) controls."
+  pluripotency_caption: iPSCs were stained with directly conjugated antibodies
+    from BD Biosciences, acquired using a FACSAria III Fusion (BD Biosciences),
+    and analyzed using FlowJo software (Treestar, Inc.). Doublets were excluded,
+    then marker-specific gates were set according to corresponding
+    fluorescence-minus-one (FMO) controls.
   trilineage_differentiation:
-    - germ_layer: "Ectoderm"
-      marker: "PAX6"
+    - germ_layer: Ectoderm
+      marker: PAX6
       percent_positive_cells: Pass
-    - germ_layer: "Endoderm"
-      marker: "SOX17"
+    - germ_layer: Endoderm
+      marker: SOX17
       percent_positive_cells: Pass
-    - germ_layer: "Mesoderm"
-      marker: "Brachyury"
+    - germ_layer: Mesoderm
+      marker: Brachyury
       percent_positive_cells: Pass
-  trilineage_caption: "iPSCs were subjected to a 5-7 day, non-terminal, directed differentiation using the STEMdiff™ Trilineage Differentiation Kit (STEMCELL Technologies, Inc.). Total RNA was isolated from each lineage specific differentiation and assayed via ddPCR for the expression of lineage specific transcripts; Pax6(Ectoderm), Sox17(Endoderm) and Brachyury(Mesoderm)."
+  trilineage_caption: iPSCs were subjected to a 5-7 day, non-terminal, directed
+    differentiation using the STEMdiff™ Trilineage Differentiation Kit (STEMCELL
+    Technologies, Inc.). Total RNA was isolated from each lineage specific
+    differentiation and assayed via ddPCR for the expression of lineage specific
+    transcripts; Pax6(Ectoderm), Sox17(Endoderm) and Brachyury(Mesoderm).
   cardiomyocyte_differentiation:
-    troponin_percent_positive: "76.8 (1)"
-    day_of_beating_percent: "100 (3)"
-    day_of_beating_range: "d11"
-  cardiomyocyte_differentiation_caption: "iPSCs were differentiated to cardiomyocytes and observed for initiation of beating starting at day 6. At ~day 12, cells were fixed and stained with anti-cardiac Troponin T (BD Biosciences) and gating was based on an isotype control. Ranges observed across multiple experiments are shown for Troponin T and Day of beating initiation; number of experiments is shown in (). "
----
+    troponin_percent_positive: 76.8 (1)
+    day_of_beating_percent: 100 (3)
+    day_of_beating_range: d11
+  cardiomyocyte_differentiation_caption: "iPSCs were differentiated to
+    cardiomyocytes and observed for initiation of beating starting at day 6. At
+    ~day 12, cells were fixed and stained with anti-cardiac Troponin T (BD
+    Biosciences) and gating was based on an isotype control. Ranges observed
+    across multiple experiments are shown for Troponin T and Day of beating
+    initiation; number of experiments is shown in (). "
+---