diff --git a/rust/fused-plan7/.gitignore b/rust/fused-plan7/.gitignore new file mode 100644 index 0000000..ea8c4bf --- /dev/null +++ b/rust/fused-plan7/.gitignore @@ -0,0 +1 @@ +/target diff --git a/rust/fused-plan7/Cargo.lock b/rust/fused-plan7/Cargo.lock new file mode 100644 index 0000000..69bba36 --- /dev/null +++ b/rust/fused-plan7/Cargo.lock @@ -0,0 +1,105 @@ +# This file is automatically @generated by Cargo. +# It is not intended for manual editing. +version = 4 + +[[package]] +name = "fused_plan7" +version = "0.1.0" +dependencies = [ + "serde_json", +] + +[[package]] +name = "itoa" +version = "1.0.18" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "8f42a60cbdf9a97f5d2305f08a87dc4e09308d1276d28c869c684d7777685682" + +[[package]] +name = "memchr" +version = "2.8.2" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "88904434abc2901f197fe8cc55f0445e7ded921dba5911dad2e2b39b48e663c4" + +[[package]] +name = "proc-macro2" +version = "1.0.106" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "8fd00f0bb2e90d81d1044c2b32617f68fcb9fa3bb7640c23e9c748e53fb30934" +dependencies = [ + "unicode-ident", +] + +[[package]] +name = "quote" +version = "1.0.45" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "41f2619966050689382d2b44f664f4bc593e129785a36d6ee376ddf37259b924" +dependencies = [ + "proc-macro2", +] + +[[package]] +name = "serde" +version = "1.0.228" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "9a8e94ea7f378bd32cbbd37198a4a91436180c5bb472411e48b5ec2e2124ae9e" +dependencies = [ + "serde_core", +] + +[[package]] +name = "serde_core" +version = "1.0.228" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "41d385c7d4ca58e59fc732af25c3983b67ac852c1a25000afe1175de458b67ad" +dependencies = [ + "serde_derive", +] + +[[package]] +name = "serde_derive" +version = "1.0.228" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "d540f220d3187173da220f885ab66608367b6574e925011a9353e4badda91d79" +dependencies = [ + "proc-macro2", + "quote", + "syn", +] + +[[package]] +name = "serde_json" +version = "1.0.150" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "e8014e44b4736ed0538adeecded0fce2a272f22dc9578a7eb6b2d9993c74cfb9" +dependencies = [ + "itoa", + "memchr", + "serde", + "serde_core", + "zmij", +] + +[[package]] +name = "syn" +version = "2.0.118" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "1b9ae57f904213ebb649ce6895b8a66c66f0203b9319718f69a5612a065b1422" +dependencies = [ + "proc-macro2", + "quote", + "unicode-ident", +] + +[[package]] +name = "unicode-ident" +version = "1.0.24" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "e6e4313cd5fcd3dad5cafa179702e2b244f760991f45397d14d4ebf38247da75" + +[[package]] +name = "zmij" +version = "1.0.21" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "b8848ee67ecc8aedbaf3e4122217aff892639231befc6a1b58d29fff4c2cabaa" diff --git a/rust/fused-plan7/Cargo.toml b/rust/fused-plan7/Cargo.toml new file mode 100644 index 0000000..b4c70af --- /dev/null +++ b/rust/fused-plan7/Cargo.toml @@ -0,0 +1,18 @@ +[package] +name = "fused_plan7" +version = "0.1.0" +edition = "2021" +description = "Fused Plan7 + transducer Forward/Viterbi kernel (Rust port of Machine Boss js/webgpu/cpu/fused-plan7.mjs). Native + wasm32." +license = "MIT" + +[lib] +name = "fused_plan7" +path = "src/lib.rs" + +[dependencies] +# serde_json + std only; the hot-path DP touches neither (wasm-safe). +serde_json = "1" + +[profile.release] +opt-level = 3 +lto = true diff --git a/rust/fused-plan7/examples/score.rs b/rust/fused-plan7/examples/score.rs new file mode 100644 index 0000000..b057558 --- /dev/null +++ b/rust/fused-plan7/examples/score.rs @@ -0,0 +1,68 @@ +//! Score one output sequence against a fused Plan7 + transducer model. +//! +//! Usage: +//! cargo run --release --example score -- \ +//! [multihit] [L] +//! +//! `params.json` may be `-` for no params (empty map). Prints two lines: +//! FORWARD +//! VITERBI +//! +//! Used by the cross-implementation check against the JS CPU reference. + +use std::collections::HashMap; +use std::process::exit; + +use fused_plan7::{ + build_fused_plan7, fused_plan7_forward, fused_plan7_viterbi, parse_hmmer, prepare_machine, + tokenize, FusedOpts, Semiring, +}; + +fn die(msg: String) -> ! { + eprintln!("error: {msg}"); + exit(1); +} + +fn main() { + let args: Vec = std::env::args().collect(); + if args.len() < 5 { + die(format!( + "usage: {} [multihit] [L]", + args[0] + )); + } + let hmm_path = &args[1]; + let td_path = &args[2]; + let params_path = &args[3]; + let seq = &args[4]; + let multihit = args.get(5).map(|s| s == "true" || s == "1").unwrap_or(false); + let l: f64 = args.get(6).and_then(|s| s.parse().ok()).unwrap_or(400.0); + + let hmm_text = std::fs::read_to_string(hmm_path).unwrap_or_else(|e| die(e.to_string())); + let model = parse_hmmer(&hmm_text).unwrap_or_else(|e| die(e)); + + let td_text = std::fs::read_to_string(td_path).unwrap_or_else(|e| die(e.to_string())); + let machine_json: serde_json::Value = + serde_json::from_str(&td_text).unwrap_or_else(|e| die(e.to_string())); + + let params: HashMap = if params_path == "-" { + HashMap::new() + } else { + let pt = std::fs::read_to_string(params_path).unwrap_or_else(|e| die(e.to_string())); + serde_json::from_str(&pt).unwrap_or_else(|e| die(e.to_string())) + }; + + let transducer = prepare_machine(&machine_json, ¶ms).unwrap_or_else(|e| die(e)); + let fm = build_fused_plan7(&model, &transducer, FusedOpts { multihit, l }); + + let tokens = if seq == "-" || seq.is_empty() { + Vec::new() + } else { + tokenize(seq, &transducer.output_alphabet).unwrap_or_else(|e| die(e)) + }; + + let fwd = fused_plan7_forward(&fm, &tokens, Semiring::LogSumExp); + let vit = fused_plan7_viterbi(&fm, &tokens); + println!("FORWARD {:.15}", fwd); + println!("VITERBI {:.15}", vit); +} diff --git a/rust/fused-plan7/src/fused.rs b/rust/fused-plan7/src/fused.rs new file mode 100644 index 0000000..379712f --- /dev/null +++ b/rust/fused-plan7/src/fused.rs @@ -0,0 +1,846 @@ +//! Fused Plan7 + transducer Forward/Viterbi kernel. +//! +//! Faithful Rust port of `js/webgpu/cpu/fused-plan7.mjs`. A 1-D DP over output +//! positions, exploiting the linear-chain structure of a Plan7 profile HMM so +//! the composed Plan7 x transducer state space is never materialized. +//! +//! The ONLY intentional deviation from the JS reference is that the transducer +//! transitions are iterated **sparsely** (see [`crate::machine_prep`]) instead +//! of densely. The numeric result is bit-faithful because absent entries are +//! NEG_INF, the identity of both semiring reduces. +//! +//! State layout (flat `Vec`, matching the JS Float64Arrays): +//! - `core_m`: `K * S_td` — M_k value (pre- or post-emission per phase) +//! - `core_i`: `K * S_td` — I_k value +//! - `core_d`: `K * S_td` — D_k (silent) +//! - `flanking`: `N_FLANKING * S_td` +//! +//! Wasm-safe: the hot DP uses only `Vec` scratch and `f64` math. + +// The DP deliberately uses explicit index loops that mirror the JS reference +// line-for-line (and whose visitation order is load-bearing for bit-identical +// logsumexp accumulation). Iterator rewrites would obscure that correspondence, +// so the `needless_range_loop` lint is intentionally allowed here. +#![allow(clippy::needless_range_loop)] + +use crate::hmmer::{calc_match_occupancy, HmmerModel}; +use crate::logmath::{safe_log, Semiring, NEG_INF}; +use crate::machine_prep::{PreparedMachine, SparseEdge}; + +// Flanking state indices (identical to the JS constants). +const N: usize = 0; +const NX: usize = 1; +const B: usize = 2; +const E: usize = 3; +const CX: usize = 4; +const C: usize = 5; +const JX: usize = 6; +const J: usize = 7; +const N_FLANKING: usize = 8; + +/// Options for [`build_fused_plan7`] (mirrors the JS `opts`). +#[derive(Clone, Copy, Debug)] +pub struct FusedOpts { + pub multihit: bool, + pub l: f64, +} + +impl Default for FusedOpts { + /// Matches the JS default `{ multihit: false, L: 400 }`. + fn default() -> Self { + FusedOpts { + multihit: false, + l: 400.0, + } + } +} + +/// The fused-machine data (`fm`) built once and reused across sequences. +/// +/// Mirrors the object returned by `buildFusedPlan7`, but the transducer is held +/// by reference to a [`PreparedMachine`] (sparse edges) rather than copied as a +/// dense tensor. +pub struct FusedPlan7<'a> { + pub k: usize, + pub n_aa: usize, + pub s_td: usize, + + // Per-node core transitions (log-space). + log_m_to_m: Vec, + log_m_to_i: Vec, + log_m_to_d: Vec, + log_i_to_m: Vec, + log_i_to_i: Vec, + log_d_to_m: Vec, + log_d_to_d: Vec, + + // Per-node emissions (log-space), flat K*n_aa. + log_match_emit: Vec, + log_ins_emit: Vec, + + // Local-mode begin entry, per node (log-space). + log_b_entry: Vec, + + // Flanking weights (log-space scalars). + log_n_loop: f64, + log_n_to_b: f64, + log_e_to_cx: f64, + log_e_to_jx: f64, + log_c_loop: f64, + log_c_to_t: f64, + log_j_loop: f64, + log_j_to_b: f64, + + // Background/null emission (log-space), length n_aa. + log_null_emit: Vec, + + // Amino-acid index -> transducer input token (0 = epsilon when unmapped). + aa_to_td_in: Vec, + + // The prepared transducer (sparse edges + dense silent matrix). + td: &'a PreparedMachine, +} + +impl<'a> FusedPlan7<'a> { + #[inline] + fn silent(&self) -> &[f64] { + &self.td.silent_dense + } + #[inline] + fn emit_edges(&self, in_tok: usize, out_tok: usize) -> &[SparseEdge] { + self.td.edges_for(in_tok, out_tok) + } +} + +/// Build the fused Plan7 data from a parsed HMMER model + prepared transducer. +/// +/// Faithful port of `buildFusedPlan7`. +pub fn build_fused_plan7<'a>( + model: &HmmerModel, + transducer: &'a PreparedMachine, + opts: FusedOpts, +) -> FusedPlan7<'a> { + let k = model.nodes.len(); + let n_aa = model.alph.len(); + let s_td = transducer.n_states; + + // Per-node core transitions. + let mut log_m_to_m = vec![0.0; k]; + let mut log_m_to_i = vec![0.0; k]; + let mut log_m_to_d = vec![0.0; k]; + let mut log_i_to_m = vec![0.0; k]; + let mut log_i_to_i = vec![0.0; k]; + let mut log_d_to_m = vec![0.0; k]; + let mut log_d_to_d = vec![0.0; k]; + for kk in 0..k { + let n = &model.nodes[kk]; + log_m_to_m[kk] = safe_log(n.m_to_m); + log_m_to_i[kk] = safe_log(n.m_to_i); + log_m_to_d[kk] = safe_log(n.m_to_d); + log_i_to_m[kk] = safe_log(n.i_to_m); + log_i_to_i[kk] = safe_log(n.i_to_i); + log_d_to_m[kk] = safe_log(n.d_to_m); + log_d_to_d[kk] = safe_log(n.d_to_d); + } + + // Per-node emissions, flat K*n_aa. + let mut log_match_emit = vec![0.0; k * n_aa]; + let mut log_ins_emit = vec![0.0; k * n_aa]; + for kk in 0..k { + for a in 0..n_aa { + log_match_emit[kk * n_aa + a] = safe_log(model.nodes[kk].match_emit[a]); + log_ins_emit[kk * n_aa + a] = safe_log(model.nodes[kk].ins_emit[a]); + } + } + + // Local-mode begin entry (occupancy-weighted). + let occ = calc_match_occupancy(model); + let mut z = 0.0_f64; + for kk in 1..k { + z += occ[kk] * (k - kk + 1) as f64; + } + let mut log_b_entry = vec![NEG_INF; k]; + if z > 0.0 { + for kk in 0..k.saturating_sub(1) { + // fused index kk maps to profile node kk+1 + log_b_entry[kk] = if occ[kk + 1] > 0.0 { + (occ[kk + 1] / z).ln() + } else { + NEG_INF + }; + } + if k >= 1 { + log_b_entry[k - 1] = NEG_INF; // last node: no entry in local + } + } + + // Flanking weights. + let l = opts.l; + let log_n_loop = (l / (l + 1.0)).ln(); + let log_n_to_b = (1.0 / (l + 1.0)).ln(); + let log_c_loop = (l / (l + 1.0)).ln(); + let log_c_to_t = (1.0 / (l + 1.0)).ln(); + + let (log_e_to_cx, log_e_to_jx, log_j_loop, log_j_to_b) = if opts.multihit { + ( + 0.5_f64.ln(), + 0.5_f64.ln(), + (l / (l + 1.0)).ln(), + (1.0 / (l + 1.0)).ln(), + ) + } else { + (0.0, NEG_INF, NEG_INF, NEG_INF) + }; + + // Null model emissions. + let mut log_null_emit = vec![0.0; n_aa]; + for a in 0..n_aa { + log_null_emit[a] = safe_log(model.null_emit[a]); + } + + // aa index -> transducer input token. + let mut aa_to_td_in = vec![0usize; n_aa]; + for a in 0..n_aa { + let sym = &model.alph[a]; + if let Some(pos) = transducer.input_alphabet.iter().position(|t| t == sym) { + aa_to_td_in[a] = pos; + } + // else 0 (epsilon) + } + + FusedPlan7 { + k, + n_aa, + s_td, + log_m_to_m, + log_m_to_i, + log_m_to_d, + log_i_to_m, + log_i_to_i, + log_d_to_m, + log_d_to_d, + log_match_emit, + log_ins_emit, + log_b_entry, + log_n_loop, + log_n_to_b, + log_e_to_cx, + log_e_to_jx, + log_c_loop, + log_c_to_t, + log_j_loop, + log_j_to_b, + log_null_emit, + aa_to_td_in, + td: transducer, + } +} + +// ========================================================================= +// Internal helpers (sparse-aware where the JS used the dense tensor) +// ========================================================================= + +/// Transducer matvec over the DENSE silent matrix: +/// `result[dst] = reduce_src(v[src] + silent[src*S + dst])`. +/// Mirrors `tdMatvec(td_silent, ...)`. +fn td_matvec_silent(silent: &[f64], v: &[f64], s_td: usize, sem: Semiring, out: &mut [f64]) { + for dst in 0..s_td { + // Iterate src ascending — same order as the JS dense reduce. + out[dst] = sem.reduce((0..s_td).map(|src| v[src] + silent[src * s_td + dst])); + } +} + +/// Propagate transducer silent transitions to a fixed point, in place on `v`. +/// Faithful port of `propagateTdSilent` (including the `v_td` base term, the +/// `1e-10` change threshold, and `maxIter = 100`). +fn propagate_td_silent(v: &mut [f64], silent: &[f64], s_td: usize, sem: Semiring) { + let v_base: Vec = v.to_vec(); + let mut current: Vec = v.to_vec(); + let mut update = vec![NEG_INF; s_td]; + let mut next = vec![NEG_INF; s_td]; + for _ in 0..100 { + td_matvec_silent(silent, ¤t, s_td, sem, &mut update); + let mut changed = false; + for i in 0..s_td { + next[i] = sem.plus(v_base[i], update[i]); + if (next[i] - current[i]).abs() > 1e-10 { + changed = true; + } + } + current.copy_from_slice(&next); + if !changed { + break; + } + } + v.copy_from_slice(¤t); +} + +/// Plan7 state emits an amino acid; transducer consumes it and produces +/// `out_tok` (sparsely). Returns the new value vector over transducer states. +/// +/// Sparse port of `tdEmitProduce`: for each aa with finite emit, fold its +/// `(aa_to_td_in[a], out_tok)` edges grouped by `dst` (src ascending) into a +/// per-dst column reduce, then `plus`-accumulate `aa_emit_log[a] + tdResult`. +fn td_emit_produce( + fm: &FusedPlan7, + v_td: &[f64], + aa_emit_log: &[f64], + out_tok: usize, + sem: Semiring, + result: &mut [f64], +) { + let s_td = fm.s_td; + for r in result.iter_mut().take(s_td) { + *r = NEG_INF; + } + for a in 0..fm.n_aa { + let emit = aa_emit_log[a]; + if emit == NEG_INF { + continue; + } + let in_tok = fm.aa_to_td_in[a]; + let edges = fm.emit_edges(in_tok, out_tok); + // Walk contiguous runs of equal dst (edges are sorted by (dst, src)). + let mut i = 0usize; + while i < edges.len() { + let dst = edges[i].dst as usize; + let mut j = i; + while j < edges.len() && edges[j].dst as usize == dst { + j += 1; + } + // Column reduce over src-ascending edges: reduce(v[src] + w). + let td_result = sem.reduce(edges[i..j].iter().map(|e| v_td[e.src as usize] + e.log_weight)); + result[dst] = sem.plus(result[dst], emit + td_result); + i = j; + } + } +} + +/// Convenience: emit with `out_tok = 0` (transducer consumes, no output). +/// Mirrors `tdEmitSilent`. +#[inline] +fn td_emit_silent( + fm: &FusedPlan7, + v_td: &[f64], + aa_emit_log: &[f64], + sem: Semiring, + result: &mut [f64], +) { + td_emit_produce(fm, v_td, aa_emit_log, 0, sem, result); +} + +/// Apply the transducer "delete" block `(in=0, out=out_tok)` to `src_vec`: +/// `out[dst] = reduce_src(src_vec[src] + td[0,out_tok,src,dst])` (sparse). +/// Returns NEG_INF for dst columns with no edge (reduce identity). +fn td_delete(fm: &FusedPlan7, src_vec: &[f64], out_tok: usize, sem: Semiring, out: &mut [f64]) { + let s_td = fm.s_td; + for o in out.iter_mut().take(s_td) { + *o = NEG_INF; + } + let edges = fm.emit_edges(0, out_tok); + let mut i = 0usize; + while i < edges.len() { + let dst = edges[i].dst as usize; + let mut j = i; + while j < edges.len() && edges[j].dst as usize == dst { + j += 1; + } + out[dst] = sem.reduce(edges[i..j].iter().map(|e| src_vec[e.src as usize] + e.log_weight)); + i = j; + } +} + +/// Single-pass propagation of the silent flanking DAG + transducer-silent +/// closure at each flanking state. Faithful port of `propagateFlankingSilent`. +fn propagate_flanking_silent(flanking: &[f64], fm: &FusedPlan7, sem: Semiring) -> Vec { + let s = fm.s_td; + let mut result = flanking.to_vec(); + + // E -> CX + for st in 0..s { + let v = result[E * s + st] + fm.log_e_to_cx; + result[CX * s + st] = sem.plus(result[CX * s + st], v); + } + // E -> JX + for st in 0..s { + let v = result[E * s + st] + fm.log_e_to_jx; + result[JX * s + st] = sem.plus(result[JX * s + st], v); + } + // NX -> B + for st in 0..s { + let v = result[NX * s + st] + fm.log_n_to_b; + result[B * s + st] = sem.plus(result[B * s + st], v); + } + // JX -> B (after E -> JX) + for st in 0..s { + let v = result[JX * s + st] + fm.log_j_to_b; + result[B * s + st] = sem.plus(result[B * s + st], v); + } + // NX -> N (n_loop) + for st in 0..s { + let v = result[NX * s + st] + fm.log_n_loop; + result[N * s + st] = sem.plus(result[N * s + st], v); + } + // CX -> C (after E -> CX) + for st in 0..s { + let v = result[CX * s + st] + fm.log_c_loop; + result[C * s + st] = sem.plus(result[C * s + st], v); + } + // JX -> J (after E -> JX) + for st in 0..s { + let v = result[JX * s + st] + fm.log_j_loop; + result[J * s + st] = sem.plus(result[J * s + st], v); + } + + // Transducer-silent closure at each flanking state. + let silent = fm.silent(); + let mut tmp = vec![NEG_INF; s]; + for f in 0..N_FLANKING { + tmp.copy_from_slice(&result[f * s..(f + 1) * s]); + propagate_td_silent(&mut tmp, silent, s, sem); + result[f * s..(f + 1) * s].copy_from_slice(&tmp); + } + result +} + +// ========================================================================= +// Main DP +// ========================================================================= + +/// Fused Plan7 + transducer Forward (or Viterbi) over `output_seq` (1-based +/// output token indices). Faithful port of `fusedPlan7Forward`. +pub fn fused_plan7_forward(fm: &FusedPlan7, output_seq: &[u32], sem: Semiring) -> f64 { + let s = fm.s_td; + let k = fm.k; + let silent = fm.silent(); + + let mut core_m = vec![NEG_INF; k * s]; + let mut core_i = vec![NEG_INF; k * s]; + let mut core_d = vec![NEG_INF; k * s]; + let mut flanking = vec![NEG_INF; N_FLANKING * s]; + + // Scratch reused across init steps. + let mut scratch = vec![NEG_INF; s]; + + // --- Initialize --- + // Step 1: S -> NX; propagate td_silent at NX. + flanking[NX * s] = 0.0; + { + scratch.copy_from_slice(&flanking[NX * s..(NX + 1) * s]); + propagate_td_silent(&mut scratch, silent, s, sem); + flanking[NX * s..(NX + 1) * s].copy_from_slice(&scratch); + } + + // Step 2: NX -> B, NX -> N. + for st in 0..s { + flanking[B * s + st] = flanking[NX * s + st] + fm.log_n_to_b; + flanking[N * s + st] = flanking[NX * s + st] + fm.log_n_loop; + } + for &f in &[B, N] { + scratch.copy_from_slice(&flanking[f * s..(f + 1) * s]); + propagate_td_silent(&mut scratch, silent, s, sem); + flanking[f * s..(f + 1) * s].copy_from_slice(&scratch); + } + + // Step 3: B -> M_k (pre-emission entry). + for kk in 0..k { + for st in 0..s { + core_m[kk * s + st] = fm.log_b_entry[kk] + flanking[B * s + st]; + } + } + + // Step 4: M_k -> E (pre-emission local exit, weight 1). + let mut e_val = vec![NEG_INF; s]; + let mut m_k = vec![NEG_INF; s]; + for kk in 0..k { + m_k.copy_from_slice(&core_m[kk * s..(kk + 1) * s]); + propagate_td_silent(&mut m_k, silent, s, sem); + for st in 0..s { + e_val[st] = sem.plus(e_val[st], m_k[st]); + } + } + flanking[E * s..(E + 1) * s].copy_from_slice(&e_val); + { + scratch.copy_from_slice(&flanking[E * s..(E + 1) * s]); + propagate_td_silent(&mut scratch, silent, s, sem); + flanking[E * s..(E + 1) * s].copy_from_slice(&scratch); + } + + // Step 5: E -> CX, E -> JX. + for st in 0..s { + flanking[CX * s + st] = flanking[E * s + st] + fm.log_e_to_cx; + flanking[JX * s + st] = flanking[E * s + st] + fm.log_e_to_jx; + } + + // Step 6: JX -> B (multi-hit increment). + for st in 0..s { + let jx_to_b = flanking[JX * s + st] + fm.log_j_to_b; + flanking[B * s + st] = sem.plus(flanking[B * s + st], jx_to_b); + } + + // Step 7: CX -> C, JX -> J. + for st in 0..s { + flanking[C * s + st] = flanking[CX * s + st] + fm.log_c_loop; + flanking[J * s + st] = flanking[JX * s + st] + fm.log_j_loop; + } + for &f in &[CX, JX, C, J] { + scratch.copy_from_slice(&flanking[f * s..(f + 1) * s]); + propagate_td_silent(&mut scratch, silent, s, sem); + flanking[f * s..(f + 1) * s].copy_from_slice(&scratch); + } + + // Step 8: Multi-hit B -> M_k entries (from JX -> B increment only). + { + let mut jx_to_b = vec![NEG_INF; s]; + for st in 0..s { + jx_to_b[st] = flanking[JX * s + st] + fm.log_j_to_b; + } + propagate_td_silent(&mut jx_to_b, silent, s, sem); + for kk in 0..k { + for st in 0..s { + core_m[kk * s + st] = + sem.plus(core_m[kk * s + st], fm.log_b_entry[kk] + jx_to_b[st]); + } + } + } + + // Initial silent Plan7 emissions. + emit_silent_core(&mut core_m, &mut core_i, fm, sem); + + let lo = output_seq.len(); + if lo == 0 { + return get_terminal_val(&flanking, fm, sem); + } + + for p in 0..lo { + let out_tok = output_seq[p] as usize; + + emit_output_step( + &mut core_m, + &mut core_i, + &mut core_d, + &mut flanking, + out_tok, + fm, + sem, + ); + + let routed = route_post_emission(&core_m, &core_i, &core_d, &flanking, fm, sem); + core_m = routed.0; + core_i = routed.1; + core_d = routed.2; + flanking = routed.3; + + emit_silent_core(&mut core_m, &mut core_i, fm, sem); + } + + get_terminal_val(&flanking, fm, sem) +} + +/// Viterbi = Forward with the max-plus semiring. Mirrors `fusedPlan7Viterbi`. +#[inline] +pub fn fused_plan7_viterbi(fm: &FusedPlan7, output_seq: &[u32]) -> f64 { + fused_plan7_forward(fm, output_seq, Semiring::MaxPlus) +} + +// ========================================================================= +// Internal DP steps +// ========================================================================= + +/// Plan7 core emits, transducer consumes silently. Modifies `core_m`/`core_i` +/// in place. Faithful port of `_emitSilentCore`. +fn emit_silent_core(core_m: &mut [f64], core_i: &mut [f64], fm: &FusedPlan7, sem: Semiring) { + let s = fm.s_td; + let n_aa = fm.n_aa; + let mut result = vec![NEG_INF; s]; + let mut v = vec![NEG_INF; s]; + + for kk in 0..fm.k { + // M_k + v.copy_from_slice(&core_m[kk * s..(kk + 1) * s]); + td_emit_silent( + fm, + &v, + &fm.log_match_emit[kk * n_aa..(kk + 1) * n_aa], + sem, + &mut result, + ); + for st in 0..s { + core_m[kk * s + st] = sem.plus(core_m[kk * s + st], result[st]); + } + // I_k + v.copy_from_slice(&core_i[kk * s..(kk + 1) * s]); + td_emit_silent( + fm, + &v, + &fm.log_ins_emit[kk * n_aa..(kk + 1) * n_aa], + sem, + &mut result, + ); + for st in 0..s { + core_i[kk * s + st] = sem.plus(core_i[kk * s + st], result[st]); + } + } +} + +/// Process one output token: Plan7 emits -> transducer produces output. +/// In-place: overwrites the four state arrays with the post-emission values. +/// Faithful port of `_emitOutputStep`. +fn emit_output_step( + core_m: &mut Vec, + core_i: &mut Vec, + core_d: &mut Vec, + flanking: &mut Vec, + out_tok: usize, + fm: &FusedPlan7, + sem: Semiring, +) { + let s = fm.s_td; + let k = fm.k; + let n_aa = fm.n_aa; + + let mut new_core_m = vec![NEG_INF; k * s]; + let mut new_core_i = vec![NEG_INF; k * s]; + let mut new_core_d = vec![NEG_INF; k * s]; + let mut new_flanking = vec![NEG_INF; N_FLANKING * s]; + + let mut emitted = vec![NEG_INF; s]; + let mut v = vec![NEG_INF; s]; + + // 1. Core M_k emits, td produces output. + for kk in 0..k { + v.copy_from_slice(&core_m[kk * s..(kk + 1) * s]); + td_emit_produce( + fm, + &v, + &fm.log_match_emit[kk * n_aa..(kk + 1) * n_aa], + out_tok, + sem, + &mut emitted, + ); + new_core_m[kk * s..(kk + 1) * s].copy_from_slice(&emitted); + } + + // 2. Core I_k emits, td produces output. + for kk in 0..k { + v.copy_from_slice(&core_i[kk * s..(kk + 1) * s]); + td_emit_produce( + fm, + &v, + &fm.log_ins_emit[kk * n_aa..(kk + 1) * n_aa], + out_tok, + sem, + &mut emitted, + ); + new_core_i[kk * s..(kk + 1) * s].copy_from_slice(&emitted); + } + + // 3. Flanking N/C/J emit background, td produces output. + let mut n_emitted = vec![NEG_INF; s]; + let mut c_emitted = vec![NEG_INF; s]; + let mut j_emitted = vec![NEG_INF; s]; + v.copy_from_slice(&flanking[N * s..(N + 1) * s]); + td_emit_produce(fm, &v, &fm.log_null_emit, out_tok, sem, &mut n_emitted); + v.copy_from_slice(&flanking[C * s..(C + 1) * s]); + td_emit_produce(fm, &v, &fm.log_null_emit, out_tok, sem, &mut c_emitted); + v.copy_from_slice(&flanking[J * s..(J + 1) * s]); + td_emit_produce(fm, &v, &fm.log_null_emit, out_tok, sem, &mut j_emitted); + + // 4. Transducer "delete" (in=0, out=out_tok) applied to all states. + let mut td_del = vec![NEG_INF; s]; + for kk in 0..k { + let base = kk * s; + td_delete(fm, &core_m[base..base + s], out_tok, sem, &mut td_del); + for dst in 0..s { + new_core_m[base + dst] = sem.plus(new_core_m[base + dst], td_del[dst]); + } + td_delete(fm, &core_i[base..base + s], out_tok, sem, &mut td_del); + for dst in 0..s { + new_core_i[base + dst] = sem.plus(new_core_i[base + dst], td_del[dst]); + } + td_delete(fm, &core_d[base..base + s], out_tok, sem, &mut td_del); + new_core_d[base..base + s].copy_from_slice(&td_del[..s]); + } + + for f in 0..N_FLANKING { + let base = f * s; + td_delete(fm, &flanking[base..base + s], out_tok, sem, &mut td_del); + for dst in 0..s { + new_flanking[base + dst] = if f == N { + sem.plus(n_emitted[dst], td_del[dst]) + } else if f == C { + sem.plus(c_emitted[dst], td_del[dst]) + } else if f == J { + sem.plus(j_emitted[dst], td_del[dst]) + } else { + td_del[dst] + }; + } + } + + *core_m = new_core_m; + *core_i = new_core_i; + *core_d = new_core_d; + *flanking = new_flanking; +} + +/// Route after emissions: inner scan over core positions for Mx->next / D->next +/// chains, insert self-loops, flanking routing, and the B-entry -> E -> CX/JX +/// closure. Faithful port of `_routePostEmission`. Returns the four new arrays. +fn route_post_emission( + core_m: &[f64], + core_i: &[f64], + core_d: &[f64], + flanking: &[f64], + fm: &FusedPlan7, + sem: Semiring, +) -> (Vec, Vec, Vec, Vec) { + let s = fm.s_td; + let k = fm.k; + let silent = fm.silent(); + + let mut m_incoming = vec![NEG_INF; s]; + let mut d_incoming = vec![NEG_INF; s]; + let mut e_accum = vec![NEG_INF; s]; + + let mut m_arriving = vec![NEG_INF; k * s]; + let mut new_core_i = vec![NEG_INF; k * s]; + + // Reused scratch. + let mut d_at_k = vec![NEG_INF; s]; + let mut m_pre_k = vec![NEG_INF; s]; + let mut mx_k = vec![NEG_INF; s]; + let mut ix_k = vec![NEG_INF; s]; + + for kk in 0..k { + // D_k: combine emit-step D_k with incoming from left, then close silent. + for st in 0..s { + d_at_k[st] = sem.plus(core_d[kk * s + st], d_incoming[st]); + } + propagate_td_silent(&mut d_at_k, silent, s, sem); + + // Pre-emission M_k from routing (ONLY m_incoming). + m_pre_k.copy_from_slice(&m_incoming); + propagate_td_silent(&mut m_pre_k, silent, s, sem); + + // Post-emission Mx_k. + mx_k.copy_from_slice(&core_m[kk * s..(kk + 1) * s]); + propagate_td_silent(&mut mx_k, silent, s, sem); + + // Post-emission Ix_k. + ix_k.copy_from_slice(&core_i[kk * s..(kk + 1) * s]); + propagate_td_silent(&mut ix_k, silent, s, sem); + + // E contributions: ONLY pre-emission M_k and D_k. + for st in 0..s { + e_accum[st] = sem.plus(e_accum[st], m_pre_k[st]); + e_accum[st] = sem.plus(e_accum[st], d_at_k[st]); + } + + // Persist pre-emission M_k. + m_arriving[kk * s..(kk + 1) * s].copy_from_slice(&m_pre_k); + + // Routing from Mx_k / Ix_k / D_k. + let mut new_m_incoming = vec![NEG_INF; s]; + let mut new_d_incoming = vec![NEG_INF; s]; + for st in 0..s { + let m_to_next = mx_k[st] + fm.log_m_to_m[kk]; + let i_from_m = mx_k[st] + fm.log_m_to_i[kk]; + let d_from_m = mx_k[st] + fm.log_m_to_d[kk]; + + let m_from_i = ix_k[st] + fm.log_i_to_m[kk]; + let i_self = ix_k[st] + fm.log_i_to_i[kk]; + + let m_from_d = d_at_k[st] + fm.log_d_to_m[kk]; + let d_from_d = d_at_k[st] + fm.log_d_to_d[kk]; + + new_m_incoming[st] = sem.plus(m_to_next, sem.plus(m_from_i, m_from_d)); + new_d_incoming[st] = sem.plus(d_from_m, d_from_d); + + new_core_i[kk * s + st] = sem.plus(i_from_m, i_self); + } + + m_incoming = new_m_incoming; + d_incoming = new_d_incoming; + } + + // Build new flanking. + let mut new_flanking = vec![NEG_INF; N_FLANKING * s]; + for st in 0..s { + new_flanking[NX * s + st] = flanking[N * s + st]; + new_flanking[CX * s + st] = flanking[C * s + st]; + new_flanking[JX * s + st] = flanking[J * s + st]; + new_flanking[E * s + st] = e_accum[st]; + } + + // Propagate silent flanking. + let closed_flanking = propagate_flanking_silent(&new_flanking, fm, sem); + + // Final core_m = pre-emission from routing + new B entry. + let mut new_core_m = vec![NEG_INF; k * s]; + let new_core_d = vec![NEG_INF; k * s]; + let mut result_flanking = closed_flanking.clone(); + + // b_val_closed = closed_flanking[B]. + for kk in 0..k { + for st in 0..s { + new_core_m[kk * s + st] = sem.plus( + m_arriving[kk * s + st], + fm.log_b_entry[kk] + closed_flanking[B * s + st], + ); + } + } + + // New B -> M_k -> E closure within this step. + let mut e_from_b = vec![NEG_INF; s]; + let mut b_mk = vec![NEG_INF; s]; + for kk in 0..k { + for st in 0..s { + b_mk[st] = fm.log_b_entry[kk] + closed_flanking[B * s + st]; + } + propagate_td_silent(&mut b_mk, silent, s, sem); + for st in 0..s { + e_from_b[st] = sem.plus(e_from_b[st], b_mk[st]); + } + } + // Add B-entry E contribution. + for st in 0..s { + result_flanking[E * s + st] = sem.plus(result_flanking[E * s + st], e_from_b[st]); + } + // E -> CX (then CX -> C). + let mut e_closed = e_from_b.clone(); + propagate_td_silent(&mut e_closed, silent, s, sem); + for st in 0..s { + let cx_inc = e_closed[st] + fm.log_e_to_cx; + result_flanking[CX * s + st] = sem.plus(result_flanking[CX * s + st], cx_inc); + let c_inc = cx_inc + fm.log_c_loop; + result_flanking[C * s + st] = sem.plus(result_flanking[C * s + st], c_inc); + } + // E -> JX -> J and JX -> B (multi-hit), plus extra B -> M_k entries. + for st in 0..s { + let jx_inc = e_closed[st] + fm.log_e_to_jx; + result_flanking[JX * s + st] = sem.plus(result_flanking[JX * s + st], jx_inc); + let j_inc = jx_inc + fm.log_j_loop; + result_flanking[J * s + st] = sem.plus(result_flanking[J * s + st], j_inc); + let b_inc = jx_inc + fm.log_j_to_b; + result_flanking[B * s + st] = sem.plus(result_flanking[B * s + st], b_inc); + for kk in 0..k { + new_core_m[kk * s + st] = + sem.plus(new_core_m[kk * s + st], fm.log_b_entry[kk] + b_inc); + } + } + + (new_core_m, new_core_i, new_core_d, result_flanking) +} + +/// Terminal value: `Cx -> T`, then close silent, read state `S_td - 1`. +/// Faithful port of `_getTerminalVal`. +fn get_terminal_val(flanking: &[f64], fm: &FusedPlan7, sem: Semiring) -> f64 { + let s = fm.s_td; + let mut cx_val = vec![NEG_INF; s]; + for st in 0..s { + cx_val[st] = flanking[CX * s + st] + fm.log_c_to_t; + } + propagate_td_silent(&mut cx_val, fm.silent(), s, sem); + cx_val[s - 1] +} diff --git a/rust/fused-plan7/src/hmmer.rs b/rust/fused-plan7/src/hmmer.rs new file mode 100644 index 0000000..a267701 --- /dev/null +++ b/rust/fused-plan7/src/hmmer.rs @@ -0,0 +1,221 @@ +//! HMMER3 profile parser. +//! +//! Faithful port of `js/webgpu/internal/hmmer-parse.mjs` (itself a port of +//! `python/machineboss/hmmer.py`). Parses an HMMER3 text profile into per-node +//! match/insert emissions and transitions, plus the SwissProt background null +//! model. Also computes match-state occupancy for local-mode entry weights. + +/// SwissProt background amino acid frequencies (same table as the JS). +const SWISSPROT_BG: &[(char, f64)] = &[ + ('A', 0.0825), + ('C', 0.0138), + ('D', 0.0546), + ('E', 0.0673), + ('F', 0.0386), + ('G', 0.0708), + ('H', 0.0227), + ('I', 0.0592), + ('K', 0.0581), + ('L', 0.0965), + ('M', 0.0241), + ('N', 0.0405), + ('P', 0.0473), + ('Q', 0.0393), + ('R', 0.0553), + ('S', 0.0663), + ('T', 0.0535), + ('V', 0.0686), + ('W', 0.0109), + ('Y', 0.0292), +]; + +fn swissprot_bg(sym: &str) -> Option { + if sym.len() != 1 { + return None; + } + let c = sym.chars().next().unwrap(); + SWISSPROT_BG.iter().find(|(k, _)| *k == c).map(|(_, v)| *v) +} + +/// One Plan7 core node. +#[derive(Clone, Debug)] +pub struct HmmerNode { + pub match_emit: Vec, + pub ins_emit: Vec, + pub m_to_m: f64, + pub m_to_i: f64, + pub m_to_d: f64, + pub i_to_m: f64, + pub i_to_i: f64, + pub d_to_m: f64, + pub d_to_d: f64, +} + +/// A parsed HMMER3 model. +#[derive(Clone, Debug)] +pub struct HmmerModel { + /// Emission alphabet (e.g. the 20 amino acids), in file order. + pub alph: Vec, + pub nodes: Vec, + pub ins0_emit: Vec, + /// Background (null) emission probabilities, parallel to `alph`. + pub null_emit: Vec, + pub b_to_m1: f64, + pub b_to_i0: f64, + pub b_to_d1: f64, + pub i0_to_m1: f64, + pub i0_to_i0: f64, +} + +/// Convert an HMMER log-probability token to a probability. +/// `"*"` → 0; otherwise `exp(-x)`. (Matches `strToProb`.) +#[inline] +fn str_to_prob(s: &str) -> f64 { + if s == "*" { + 0.0 + } else { + (-s.parse::().unwrap_or(f64::INFINITY)).exp() + } +} + +fn ws_split(line: &str) -> Vec<&str> { + line.split_whitespace().collect() +} + +/// Parse an HMMER3-format text string. +/// +/// Mirrors `parseHmmer`: locate the `HMM` alphabet line, skip the transition +/// header / COMPO / node-0 insert lines, read node-0 inserts + begin +/// transitions, then read `(match, insert, transition)` triples per node until +/// `//`. +pub fn parse_hmmer(text: &str) -> Result { + let lines: Vec<&str> = text.split('\n').collect(); + let mut model = HmmerModel { + alph: Vec::new(), + nodes: Vec::new(), + ins0_emit: Vec::new(), + null_emit: Vec::new(), + b_to_m1: 0.0, + b_to_i0: 0.0, + b_to_d1: 0.0, + i0_to_m1: 0.0, + i0_to_i0: 0.0, + }; + + let mut idx = 0usize; + while idx < lines.len() { + let line = lines[idx]; + // Match a line beginning with "HMM" followed by whitespace. + let is_hmm_line = { + let t = line; + (t.starts_with("HMM ") || t.starts_with("HMM\t")) + && t.len() >= 3 + }; + if is_hmm_line { + let tokens = ws_split(line); + if tokens.len() <= 1 { + return Err("HMMER parse error: no alphabet found on the HMM line. \ + Is this a valid HMMER3 profile file?" + .to_string()); + } + model.alph = tokens[1..].iter().map(|s| s.to_string()).collect(); + let n_alph = model.alph.len(); + + // Skip transition header line, COMPO line, node 0 insert emission line. + idx += 3; + + // Node 0 insert emissions. + let ins0 = ws_split(lines[idx]); + if ins0.len() != n_alph { + return Err(format!( + "HMMER parse error at node 0 insert emissions: expected {} values, got {}. \ + The file may be truncated or corrupted.", + n_alph, + ins0.len() + )); + } + model.ins0_emit = ins0.iter().map(|s| str_to_prob(s)).collect(); + idx += 1; + + // Begin transitions. + let bt = ws_split(lines[idx]); + model.b_to_m1 = str_to_prob(bt[0]); + model.b_to_i0 = str_to_prob(bt[1]); + model.b_to_d1 = str_to_prob(bt[2]); + model.i0_to_m1 = str_to_prob(bt[3]); + model.i0_to_i0 = str_to_prob(bt[4]); + idx += 1; + + // Parse nodes. + while idx < lines.len() { + let l = lines[idx]; + if l.starts_with("//") { + break; + } + let match_fields = ws_split(l); + if match_fields.len() != n_alph + 6 { + return Err(format!( + "HMMER parse error at match emission line: expected {} fields, got {}. \ + The file may be truncated or corrupted.", + n_alph + 6, + match_fields.len() + )); + } + idx += 1; + let ins_fields = ws_split(lines[idx]); + idx += 1; + let trans_fields = ws_split(lines[idx]); + if trans_fields.len() != 7 { + return Err(format!( + "HMMER parse error at transition line: expected 7 fields, got {}. \ + The file may be truncated or corrupted.", + trans_fields.len() + )); + } + idx += 1; + + model.nodes.push(HmmerNode { + match_emit: match_fields[1..n_alph + 1] + .iter() + .map(|s| str_to_prob(s)) + .collect(), + ins_emit: ins_fields.iter().map(|s| str_to_prob(s)).collect(), + m_to_m: str_to_prob(trans_fields[0]), + m_to_i: str_to_prob(trans_fields[1]), + m_to_d: str_to_prob(trans_fields[2]), + i_to_m: str_to_prob(trans_fields[3]), + i_to_i: str_to_prob(trans_fields[4]), + d_to_m: str_to_prob(trans_fields[5]), + d_to_d: str_to_prob(trans_fields[6]), + }); + } + break; + } + idx += 1; + } + + // Null model (SwissProt background; uniform fallback for unknown symbols). + let n_alph = model.alph.len(); + model.null_emit = model + .alph + .iter() + .map(|sym| swissprot_bg(sym).unwrap_or(1.0 / n_alph as f64)) + .collect(); + + Ok(model) +} + +/// Match-state occupancy for local-mode entry weights. +/// Port of `calcMatchOccupancy` / `HmmerModel.calc_match_occupancy()`. +pub fn calc_match_occupancy(model: &HmmerModel) -> Vec { + let k = model.nodes.len(); + let mut mocc = vec![0.0_f64; k]; + if k > 1 { + mocc[1] = model.nodes[0].m_to_i + model.nodes[0].m_to_m; + } + for kk in 2..k { + mocc[kk] = mocc[kk - 1] * (model.nodes[kk].m_to_m + model.nodes[kk].m_to_i) + + (1.0 - mocc[kk - 1]) * model.nodes[kk].d_to_m; + } + mocc +} diff --git a/rust/fused-plan7/src/lib.rs b/rust/fused-plan7/src/lib.rs new file mode 100644 index 0000000..1cafd31 --- /dev/null +++ b/rust/fused-plan7/src/lib.rs @@ -0,0 +1,85 @@ +//! Fused Plan7 + transducer Forward/Viterbi kernel (Rust). +//! +//! A faithful, numerically close-to-bit-identical port of Machine Boss's CPU +//! JavaScript reference `js/webgpu/cpu/fused-plan7.mjs` (which is itself the +//! reference for the WebGPU f32 kernel). It scores an output sequence (e.g. DNA) +//! against a protein Plan7 profile HMM *fused* with a protein->output transducer +//! (e.g. a codon + intron model), without materializing the composed state space. +//! +//! # What this crate provides +//! +//! - [`parse_hmmer`] — parse an HMMER3 text profile (self-contained). +//! - [`prepare_machine`] — turn a Machine Boss JSON transducer + params into a +//! SPARSE log-transition representation (see below). +//! - [`tokenize`] — map a symbol string to 1-based token indices. +//! - [`build_fused_plan7`] — build the fused-machine data (`fm`) once. +//! - [`fused_plan7_forward`] / [`fused_plan7_viterbi`] — run the DP. +//! +//! # Sparse transducer (the key efficiency change vs. the JS reference) +//! +//! The JS CPU reference iterates the DENSE `S_td x S_td` transducer matrix for +//! every emission (`O(L * K * S_td^2)`). For real transducers (e.g. `prot2dna` +//! with ~132 states) that is far too slow. This crate iterates only the +//! transitions that actually exist: per `(in_tok, out_tok)`, a list of +//! `(src, dst, log_weight)` edges (plus the dense silent block, which the +//! fixed-point silent closure genuinely needs dense). Cost becomes +//! `O(L * K * nnz)`. Skipping absent (`NEG_INF`) entries is exactly equivalent +//! to the dense reduce because `NEG_INF` is the identity of both the logsumexp +//! and the max-plus reduce. +//! +//! # Numerics +//! +//! All math is f64. Per-column reduces are performed in the same order +//! (`src` ascending) and with the same two-pass logsumexp formulation as the JS +//! `reduce`, so results match the CPU JS reference to tight tolerance (Forward +//! within ~1e-6, Viterbi essentially exact on the test fixtures). +//! +//! # Wasm +//! +//! The crate builds for `wasm32-unknown-unknown`. The hot DP path uses only +//! `Vec` scratch and `f64` math (no threads / filesystem). `serde_json` is +//! used only to parse a transducer JSON `Value` up front. +//! +//! # Calling from another Rust crate +//! +//! ```no_run +//! use std::collections::HashMap; +//! use serde_json::Value; +//! use fused_plan7::{ +//! parse_hmmer, prepare_machine, tokenize, +//! build_fused_plan7, fused_plan7_forward, fused_plan7_viterbi, +//! FusedOpts, Semiring, +//! }; +//! +//! # fn run() -> Result<(), String> { +//! let hmm_text: String = std::fs::read_to_string("profile.hmm").map_err(|e| e.to_string())?; +//! let model = parse_hmmer(&hmm_text)?; +//! +//! let machine_json: Value = +//! serde_json::from_str(&std::fs::read_to_string("prot2dna.json").map_err(|e| e.to_string())?) +//! .map_err(|e| e.to_string())?; +//! let params: HashMap = HashMap::new(); // fill codon/flank params +//! let transducer = prepare_machine(&machine_json, ¶ms)?; +//! +//! let fm = build_fused_plan7(&model, &transducer, FusedOpts { multihit: false, l: 400.0 }); +//! +//! let dna = tokenize("ATGGCAGATGAA", &transducer.output_alphabet)?; +//! let fwd = fused_plan7_forward(&fm, &dna, Semiring::LogSumExp); +//! let vit = fused_plan7_viterbi(&fm, &dna); +//! println!("forward={fwd} viterbi={vit}"); +//! # Ok(()) +//! # } +//! ``` + +pub mod fused; +pub mod hmmer; +pub mod logmath; +pub mod machine_prep; + +// ---- Public re-exports (the documented API surface) ---- +pub use fused::{build_fused_plan7, fused_plan7_forward, fused_plan7_viterbi, FusedOpts, FusedPlan7}; +pub use hmmer::{calc_match_occupancy, parse_hmmer, HmmerModel, HmmerNode}; +pub use logmath::{logaddexp, logmax, safe_log, Semiring, NEG_INF}; +pub use machine_prep::{ + evaluate_weight, prepare_machine, token_index, tokenize, PreparedMachine, SparseEdge, +}; diff --git a/rust/fused-plan7/src/logmath.rs b/rust/fused-plan7/src/logmath.rs new file mode 100644 index 0000000..b621e53 --- /dev/null +++ b/rust/fused-plan7/src/logmath.rs @@ -0,0 +1,170 @@ +//! Log-space arithmetic utilities. +//! +//! Faithful port of `js/webgpu/internal/logmath.mjs`. All DP values are stored +//! as log-probabilities. `NEG_INF` represents `log(0) = -inf`. The "plus" of the +//! semiring is `logaddexp` (Forward) or `max` (Viterbi); the array "reduce" is +//! the corresponding fold over an iterator of values. +//! +//! Wasm-safe: no allocation, no std I/O, no threads. + +/// log(0) = -infinity. +pub const NEG_INF: f64 = f64::NEG_INFINITY; + +/// `log(exp(a) + exp(b))`, numerically stable. Matches `logaddexp` in +/// `logmath.mjs` exactly (including the `a === NEG_INF` / `b === NEG_INF` +/// short-circuits, which keep `NEG_INF` an identity element). +#[inline] +pub fn logaddexp(a: f64, b: f64) -> f64 { + if a == NEG_INF { + return b; + } + if b == NEG_INF { + return a; + } + let m = if a > b { a } else { b }; + m + ((a - m).exp() + (b - m).exp()).ln() +} + +/// `max(a, b)` — the "plus" of the max-plus (Viterbi) semiring. +#[inline] +pub fn logmax(a: f64, b: f64) -> f64 { + if a > b { + a + } else { + b + } +} + +/// Which semiring a DP runs in. +#[derive(Clone, Copy, Debug, PartialEq, Eq)] +pub enum Semiring { + /// Forward: plus = logaddexp, reduce = logsumexp. + LogSumExp, + /// Viterbi: plus = max, reduce = max. + MaxPlus, +} + +impl Semiring { + /// Parse the string semiring names used by the JS reference + /// (`"logsumexp"` / `"maxplus"`). + pub fn parse_name(s: &str) -> Option { + match s { + "logsumexp" => Some(Semiring::LogSumExp), + "maxplus" => Some(Semiring::MaxPlus), + _ => None, + } + } + + /// Semiring "plus": combine two scalars. + /// + /// For `LogSumExp` this is `logaddexp`; for `MaxPlus` this is `max`. + #[inline] + pub fn plus(self, a: f64, b: f64) -> f64 { + match self { + Semiring::LogSumExp => logaddexp(a, b), + Semiring::MaxPlus => logmax(a, b), + } + } + + /// Semiring "reduce" over an iterator of values. + /// + /// Mirrors the JS `reduce(arr)`: + /// - max-plus: the maximum (NEG_INF if empty). + /// - logsumexp: `m + log(sum exp(x_i - m))` over finite entries, where `m` + /// is the max; returns NEG_INF if the max is NEG_INF. + /// + /// IMPORTANT: this performs a single max scan then a single sum scan, in the + /// same order the JS does, so the float64 result is bit-identical for a given + /// iteration order. Callers must pass values in the same order as the JS + /// (`src` ascending) to stay bit-identical. + #[inline] + pub fn reduce(self, iter: I) -> f64 + where + I: IntoIterator + Clone, + { + match self { + Semiring::MaxPlus => { + let mut m = NEG_INF; + for x in iter { + if x > m { + m = x; + } + } + m + } + Semiring::LogSumExp => { + let mut m = NEG_INF; + for x in iter.clone() { + if x > m { + m = x; + } + } + if m == NEG_INF { + return NEG_INF; + } + let mut s = 0.0_f64; + for x in iter { + if x != NEG_INF { + s += (x - m).exp(); + } + } + m + s.ln() + } + } + } +} + +/// `log(x)` with `log(0) = NEG_INF` (the JS `safeLog` / `strToProb`+log idiom). +#[inline] +pub fn safe_log(x: f64) -> f64 { + if x > 0.0 { + x.ln() + } else { + NEG_INF + } +} + +#[cfg(test)] +mod tests { + use super::*; + + #[test] + fn neg_inf_is_identity() { + assert_eq!(logaddexp(NEG_INF, -1.5), -1.5); + assert_eq!(logaddexp(-1.5, NEG_INF), -1.5); + assert_eq!(logaddexp(NEG_INF, NEG_INF), NEG_INF); + assert_eq!(logmax(NEG_INF, -2.0), -2.0); + } + + #[test] + fn logaddexp_matches_definition() { + // log(exp(a)+exp(b)) computed naively for small finite values. + for &(a, b) in &[(-1.0_f64, -2.0_f64), (0.0, 0.0), (-10.0, -0.1), (3.0, -3.0)] { + let naive = (a.exp() + b.exp()).ln(); + assert!((logaddexp(a, b) - naive).abs() < 1e-12, "a={a} b={b}"); + } + } + + #[test] + fn reduce_semirings() { + let xs = [-1.0_f64, -3.0, NEG_INF, -2.0]; + assert_eq!(Semiring::MaxPlus.reduce(xs.iter().copied()), -1.0); + let lse = Semiring::LogSumExp.reduce(xs.iter().copied()); + let naive = ((-1.0_f64).exp() + (-3.0_f64).exp() + (-2.0_f64).exp()).ln(); + assert!((lse - naive).abs() < 1e-12); + // Empty / all-NEG_INF reduce to NEG_INF in both semirings. + assert_eq!(Semiring::LogSumExp.reduce(std::iter::empty()), NEG_INF); + assert_eq!( + Semiring::LogSumExp.reduce([NEG_INF, NEG_INF].iter().copied()), + NEG_INF + ); + assert_eq!(Semiring::MaxPlus.reduce(std::iter::empty()), NEG_INF); + } + + #[test] + fn semiring_parse_name() { + assert_eq!(Semiring::parse_name("logsumexp"), Some(Semiring::LogSumExp)); + assert_eq!(Semiring::parse_name("maxplus"), Some(Semiring::MaxPlus)); + assert_eq!(Semiring::parse_name("nope"), None); + } +} diff --git a/rust/fused-plan7/src/machine_prep.rs b/rust/fused-plan7/src/machine_prep.rs new file mode 100644 index 0000000..33f7f40 --- /dev/null +++ b/rust/fused-plan7/src/machine_prep.rs @@ -0,0 +1,442 @@ +//! Machine preparation: JSON transducer + params -> SPARSE log-transition lists. +//! +//! Faithful port of `js/webgpu/internal/machine-prep.mjs`, EXCEPT the transition +//! tensor is stored sparsely instead of as a dense `[n_in * n_out * S * S]` +//! array. The JS reference iterates the dense `S*S` block for every emission; +//! for a real transducer (e.g. `prot2dna` with ~132 states) that is +//! `O(L * K * S^2)`. We instead store, per `(in_tok, out_tok)`, the list of +//! `(src, dst, log_weight)` actually present, giving `O(L * K * nnz)`. +//! +//! Skipping `NEG_INF` (absent) entries is *exactly* behaviour-preserving: the +//! semiring reduce (logsumexp / max) treats `NEG_INF` as its identity, so a +//! sparse fold over present entries equals the dense reduce over all entries. +//! +//! Token convention (identical to JS): token 0 is the null (epsilon/gap) token; +//! real tokens are 1-based indices into the sorted alphabet. + +use serde_json::Value; +use std::collections::BTreeMap; +use std::collections::HashMap; + +use crate::logmath::{logaddexp, NEG_INF}; + +/// One sparse transition: `value[dst] = plus(value[dst], v[src] + log_weight)`. +#[derive(Clone, Copy, Debug)] +pub struct SparseEdge { + pub src: u32, + pub dst: u32, + pub log_weight: f64, +} + +/// A prepared machine with sparse log-transition lists. +/// +/// Mirrors `PreparedMachine` but stores transitions sparsely. The dense layout +/// it replaces was `logTrans[in*nOut*S*S + out*S*S + src*S + dst]`. +#[derive(Clone, Debug)] +pub struct PreparedMachine { + pub n_states: usize, + pub n_input_tokens: usize, + pub n_output_tokens: usize, + pub input_alphabet: Vec, + pub output_alphabet: Vec, + /// Sparse edges keyed by `(in_tok, out_tok)`. Within each list, edges are + /// sorted by `dst` ascending then `src` ascending. The DP consumes them + /// grouped by `dst`: for each `dst` it folds `v[src] + log_weight` over the + /// contiguous run of edges with that `dst`, in `src`-ascending order. That is + /// exactly the per-column reduce the dense JS scan performs + /// (`reduce_src(v[src] + trans[src*S+dst])`), so the logsumexp accumulation is + /// bit-identical. (Absent `src` entries are NEG_INF = reduce identity, so + /// skipping them changes nothing.) + pub edges: HashMap<(usize, usize), Vec>, + /// The silent block `(in=0, out=0)` as a dense `S*S` matrix in row-major + /// `[src*S + dst]` order (NEG_INF where absent). The JS `td_silent` is used + /// densely (fixed-point iteration touches every entry), so we keep it dense + /// too for an exact match. + pub silent_dense: Vec, +} + +impl PreparedMachine { + /// Borrow the sparse edge list for `(in_tok, out_tok)`, or an empty slice. + #[inline] + pub fn edges_for(&self, in_tok: usize, out_tok: usize) -> &[SparseEdge] { + match self.edges.get(&(in_tok, out_tok)) { + Some(v) => v.as_slice(), + None => &[], + } + } +} + +/// Evaluate a weight expression to f64 given params + defs. +/// +/// Faithful port of `evaluateWeight` (which mirrors `weight.py:evaluate`). +/// Supports number / bool / string (param or def lookup) / `{*,+,-,/,pow,log,exp,not}`. +pub fn evaluate_weight( + w: &Value, + params: &HashMap, + defs: &HashMap, +) -> Result { + match w { + Value::Null => Ok(0.0), + Value::Bool(b) => Ok(if *b { 1.0 } else { 0.0 }), + Value::Number(n) => n + .as_f64() + .ok_or_else(|| "weight: non-finite number".to_string()), + Value::String(s) => { + if let Some(v) = params.get(s) { + Ok(*v) + } else if let Some(d) = defs.get(s) { + evaluate_weight(d, params, defs) + } else { + Err(format!( + "Unknown parameter \"{}\". Pass it in the params map.", + s + )) + } + } + Value::Object(map) => { + // Binary operators take a 2-element array. + let bin = |key: &str| -> Option<(&Value, &Value)> { + map.get(key).and_then(|v| v.as_array()).and_then(|a| { + if a.len() == 2 { + Some((&a[0], &a[1])) + } else { + None + } + }) + }; + if let Some((a, b)) = bin("*") { + return Ok(evaluate_weight(a, params, defs)? * evaluate_weight(b, params, defs)?); + } + if let Some((a, b)) = bin("+") { + return Ok(evaluate_weight(a, params, defs)? + evaluate_weight(b, params, defs)?); + } + if let Some((a, b)) = bin("-") { + return Ok(evaluate_weight(a, params, defs)? - evaluate_weight(b, params, defs)?); + } + if let Some((a, b)) = bin("/") { + return Ok(evaluate_weight(a, params, defs)? / evaluate_weight(b, params, defs)?); + } + if let Some((base, exp)) = bin("pow") { + return Ok(evaluate_weight(base, params, defs)? + .powf(evaluate_weight(exp, params, defs)?)); + } + if let Some(v) = map.get("log") { + return Ok(evaluate_weight(v, params, defs)?.ln()); + } + if let Some(v) = map.get("exp") { + return Ok(evaluate_weight(v, params, defs)?.exp()); + } + if let Some(v) = map.get("not") { + return Ok(1.0 - evaluate_weight(v, params, defs)?); + } + Err(format!( + "Unsupported weight operator \"{}\". Supported: *, +, -, /, pow, log, exp, not", + map.keys().cloned().collect::>().join(", ") + )) + } + _ => Err("Unsupported weight expression type".to_string()), + } +} + +/// Canonicalize a state id/`to` reference to a lookup key, matching the JS +/// `Array.isArray(name) ? JSON.stringify(name) : name`. +fn ref_key(v: &Value) -> String { + match v { + Value::String(s) => s.clone(), + Value::Array(_) | Value::Object(_) => serde_json::to_string(v).unwrap_or_default(), + Value::Number(n) => n.to_string(), + _ => serde_json::to_string(v).unwrap_or_default(), + } +} + +/// Build a sorted token alphabet (index 0 = null/epsilon), mirroring +/// `buildAlphabet`: collect every non-empty `direction` token over all +/// transitions, sort lexicographically, prepend "". +fn build_alphabet(states: &[Value], direction: &str) -> Vec { + let mut set = std::collections::BTreeSet::new(); + for st in states { + if let Some(trans) = st.get("trans").and_then(|t| t.as_array()) { + for t in trans { + if let Some(tok) = t.get(direction).and_then(|x| x.as_str()) { + if !tok.is_empty() { + set.insert(tok.to_string()); + } + } + } + } + } + let mut out = vec![String::new()]; + out.extend(set); + out +} + +/// Prepare a machine JSON + params into sparse log-transition lists. +/// +/// Faithful port of `prepareMachine` but sparse. Duplicate transitions for the +/// same `(in, out, src, dst)` are combined with `logaddexp`, exactly as the JS. +pub fn prepare_machine( + machine_json: &Value, + params: &HashMap, +) -> Result { + let states = machine_json + .get("state") + .and_then(|s| s.as_array()) + .ok_or_else(|| "machine JSON has no \"state\" array".to_string())?; + + let defs: HashMap = match machine_json.get("defs").and_then(|d| d.as_object()) { + Some(obj) => obj.iter().map(|(k, v)| (k.clone(), v.clone())).collect(), + None => HashMap::new(), + }; + + let s = states.len(); + let input_alphabet = build_alphabet(states, "in"); + let output_alphabet = build_alphabet(states, "out"); + let n_in = input_alphabet.len(); + let n_out = output_alphabet.len(); + + // token -> index maps + let in_tok_idx: HashMap<&str, usize> = input_alphabet + .iter() + .enumerate() + .map(|(i, t)| (t.as_str(), i)) + .collect(); + let out_tok_idx: HashMap<&str, usize> = output_alphabet + .iter() + .enumerate() + .map(|(i, t)| (t.as_str(), i)) + .collect(); + + // Resolve state name references to indices (id can be string/array/number; + // numeric index always maps to itself). + let mut name_to_idx: HashMap = HashMap::new(); + for (i, st) in states.iter().enumerate() { + if let Some(id) = st.get("id") { + name_to_idx.insert(ref_key(id), i); + } + name_to_idx.insert(i.to_string(), i); + } + + let resolve_dest = |dest: &Value| -> Result { + if let Some(n) = dest.as_u64() { + return Ok(n as usize); + } + let key = ref_key(dest); + name_to_idx + .get(&key) + .copied() + .ok_or_else(|| format!("Transition references unknown state \"{}\".", key)) + }; + + // Accumulate into a (in,out,src,dst) -> log_weight map so duplicate + // transitions are logaddexp-combined (matching the JS dense fill). + // BTreeMap keeps deterministic iteration; we re-sort per (in,out) list below. + let mut acc: BTreeMap<(usize, usize, u32, u32), f64> = BTreeMap::new(); + + for (src, st) in states.iter().enumerate() { + if let Some(trans) = st.get("trans").and_then(|t| t.as_array()) { + for t in trans { + let to = t + .get("to") + .ok_or_else(|| "transition missing \"to\"".to_string())?; + let dst = resolve_dest(to)?; + let in_idx = match t.get("in").and_then(|x| x.as_str()) { + Some(tok) if !tok.is_empty() => *in_tok_idx + .get(tok) + .ok_or_else(|| format!("unknown input token \"{}\"", tok))?, + _ => 0, + }; + let out_idx = match t.get("out").and_then(|x| x.as_str()) { + Some(tok) if !tok.is_empty() => *out_tok_idx + .get(tok) + .ok_or_else(|| format!("unknown output token \"{}\"", tok))?, + _ => 0, + }; + let weight_expr = t.get("weight").cloned().unwrap_or(Value::from(1)); + let log_weight = evaluate_weight(&weight_expr, params, &defs)?.ln(); + let key = (in_idx, out_idx, src as u32, dst as u32); + acc.entry(key) + .and_modify(|w| *w = logaddexp(*w, log_weight)) + .or_insert(log_weight); + } + } + } + + // Materialize sparse edge lists per (in,out), then sort each list by + // (dst, src) so the DP can fold per-dst columns in src-ascending order + // (bit-identical to the dense per-column reduce; see the `edges` doc). + let mut edges: HashMap<(usize, usize), Vec> = HashMap::new(); + let mut silent_dense = vec![NEG_INF; s * s]; + for ((in_idx, out_idx, src, dst), lw) in acc.into_iter() { + edges + .entry((in_idx, out_idx)) + .or_default() + .push(SparseEdge { + src, + dst, + log_weight: lw, + }); + if in_idx == 0 && out_idx == 0 { + silent_dense[src as usize * s + dst as usize] = lw; + } + } + for list in edges.values_mut() { + list.sort_by(|a, b| a.dst.cmp(&b.dst).then(a.src.cmp(&b.src))); + } + + Ok(PreparedMachine { + n_states: s, + n_input_tokens: n_in, + n_output_tokens: n_out, + input_alphabet, + output_alphabet, + edges, + silent_dense, + }) +} + +/// 1-based token index for `symbol` in `alphabet` (index 0 = null). +/// Mirrors `tokenIndex`. +pub fn token_index(alphabet: &[String], symbol: &str) -> Result { + alphabet + .iter() + .position(|a| a == symbol) + .map(|p| p as u32) + .ok_or_else(|| { + format!( + "Unknown symbol \"{}\". Valid symbols: {}", + symbol, + alphabet[1..].join(", ") + ) + }) +} + +/// Convert a string of single-character symbols to 1-based token indices. +/// Mirrors `tokenize` for the string-input case. +pub fn tokenize(seq: &str, alphabet: &[String]) -> Result, String> { + seq.chars() + .map(|c| token_index(alphabet, &c.to_string())) + .collect() +} + +#[cfg(test)] +mod tests { + use super::*; + use crate::logmath::Semiring; + use serde_json::json; + + #[test] + fn evaluate_weight_operators() { + let p: HashMap = [("x".to_string(), 2.0), ("y".to_string(), 3.0)] + .into_iter() + .collect(); + let d: HashMap = HashMap::new(); + assert_eq!(evaluate_weight(&json!({"*": ["x", "y"]}), &p, &d).unwrap(), 6.0); + assert_eq!(evaluate_weight(&json!({"+": ["x", "y"]}), &p, &d).unwrap(), 5.0); + assert_eq!(evaluate_weight(&json!({"-": ["y", "x"]}), &p, &d).unwrap(), 1.0); + assert_eq!(evaluate_weight(&json!({"/": ["y", "x"]}), &p, &d).unwrap(), 1.5); + assert_eq!(evaluate_weight(&json!({"pow": ["x", "y"]}), &p, &d).unwrap(), 8.0); + assert_eq!(evaluate_weight(&json!({"not": 0.25}), &p, &d).unwrap(), 0.75); + assert!((evaluate_weight(&json!({"exp": {"log": "x"}}), &p, &d).unwrap() - 2.0).abs() < 1e-12); + assert_eq!(evaluate_weight(&json!(1), &p, &d).unwrap(), 1.0); + assert_eq!(evaluate_weight(&Value::Null, &p, &d).unwrap(), 0.0); + assert!(evaluate_weight(&json!("missing"), &p, &d).is_err()); + } + + #[test] + fn defs_lookup_resolves() { + let machine = json!({ + "defs": { "half": 0.5 }, + "state": [{ "id": "S", "trans": [{ "to": "S", "in": "a", "out": "a", "weight": "half" }] }] + }); + let prep = prepare_machine(&machine, &HashMap::new()).unwrap(); + // log(0.5) on the single (in=a,out=a) edge. + let e = prep.edges_for(1, 1); + assert_eq!(e.len(), 1); + assert!((e[0].log_weight - 0.5_f64.ln()).abs() < 1e-12); + } + + /// The core correctness claim of the sparse representation: folding the + /// sparse per-`dst` edge lists equals reducing the equivalent DENSE `S*S` + /// matrix (NEG_INF where absent). Verified for both semirings on a small + /// multi-state transducer with a random-ish source vector. + #[test] + fn sparse_fold_equals_dense_reduce() { + // 3-state machine, a single (in=a,out=b) block plus some silent edges. + let machine = json!({ + "state": [ + { "id": 0, "trans": [ + { "to": 1, "in": "a", "out": "b", "weight": 0.5 }, + { "to": 2, "in": "a", "out": "b", "weight": 0.25 }, + { "to": 0 } // silent self-loop weight 1 + ]}, + { "id": 1, "trans": [ + { "to": 2, "in": "a", "out": "b", "weight": 0.1 }, + { "to": 1, "in": "a", "out": "b", "weight": 0.7 } + ]}, + { "id": 2, "trans": [ + { "to": 0, "in": "a", "out": "b", "weight": 0.9 } + ]} + ] + }); + let prep = prepare_machine(&machine, &HashMap::new()).unwrap(); + let s = prep.n_states; + assert_eq!(s, 3); + // tokens: in alphabet ["","a"], out ["","b"] -> a=1, b=1. + let (in_tok, out_tok) = (1usize, 1usize); + + // Build the dense block for (in_tok,out_tok). + let mut dense = vec![NEG_INF; s * s]; + for e in prep.edges_for(in_tok, out_tok) { + dense[e.src as usize * s + e.dst as usize] = e.log_weight; + } + + let v = [-0.3_f64, -1.2, -2.5]; + for sem in [Semiring::LogSumExp, Semiring::MaxPlus] { + // Dense reduce per column (the JS tdMatvec). + let dense_out: Vec = (0..s) + .map(|dst| sem.reduce((0..s).map(|src| v[src] + dense[src * s + dst]))) + .collect(); + // Sparse fold per dst-group (what td_emit/td_delete do). + let edges = prep.edges_for(in_tok, out_tok); + let mut sparse_out = vec![NEG_INF; s]; + let mut i = 0; + while i < edges.len() { + let dst = edges[i].dst as usize; + let mut j = i; + while j < edges.len() && edges[j].dst as usize == dst { + j += 1; + } + sparse_out[dst] = + sem.reduce(edges[i..j].iter().map(|e| v[e.src as usize] + e.log_weight)); + i = j; + } + for st in 0..s { + let (a, b) = (dense_out[st], sparse_out[st]); + assert!( + (a == NEG_INF && b == NEG_INF) || (a - b).abs() < 1e-15, + "{:?} col {}: dense {} vs sparse {}", + sem, + st, + a, + b + ); + } + } + } + + #[test] + fn duplicate_transitions_logaddexp_combine() { + // Two identical (in=a,out=b,src=0,dst=0) edges should combine via logaddexp. + let machine = json!({ + "state": [{ "id": 0, "trans": [ + { "to": 0, "in": "a", "out": "b", "weight": 0.3 }, + { "to": 0, "in": "a", "out": "b", "weight": 0.4 } + ]}] + }); + let prep = prepare_machine(&machine, &HashMap::new()).unwrap(); + let e = prep.edges_for(1, 1); + assert_eq!(e.len(), 1, "duplicate edges merge into one"); + let expected = crate::logmath::logaddexp(0.3_f64.ln(), 0.4_f64.ln()); + assert!((e[0].log_weight - expected).abs() < 1e-15); + } +} diff --git a/rust/fused-plan7/tests/fused_plan7.rs b/rust/fused-plan7/tests/fused_plan7.rs new file mode 100644 index 0000000..0c71e09 --- /dev/null +++ b/rust/fused-plan7/tests/fused_plan7.rs @@ -0,0 +1,332 @@ +//! Correctness tests for the fused Plan7 + transducer kernel. +//! +//! Ground truth: +//! - The `boss` CLI Forward/Viterbi for the AA-echo + fn3 fixtures +//! (`boss --hmmer-plan7 t/hmmer/fn3.hmm --compose aaecho --output-chars SEQ -L|-V`, +//! and `--hmmer-multihit` for the multihit variants). For these fixtures the +//! JS CPU reference itself agrees with `boss`, so they pin the algorithm. +//! - The JS CPU reference (`js/webgpu/cpu/fused-plan7.mjs`) for the +//! `prot2dna`-fused cases (PF03184), captured by running node on the same +//! input. (The JS reference has a known, pre-existing divergence from `boss` +//! on multi-state output-emitting transducers; this port reproduces the JS +//! reference faithfully, which is the stated requirement.) +//! +//! The Cabinet-data tests (PF03184 + prot2dna) are skipped gracefully if the +//! external data directory is not present, so the suite still runs in a bare +//! checkout. The fn3 tests are in-repo and always run. + +use std::collections::HashMap; +use std::path::PathBuf; + +use fused_plan7::{ + build_fused_plan7, fused_plan7_forward, fused_plan7_viterbi, parse_hmmer, prepare_machine, + tokenize, FusedOpts, Semiring, +}; +use serde_json::{json, Value}; + +/// Repo root = crate dir / ../.. (crate lives at /rust/fused-plan7). +fn repo_root() -> PathBuf { + let mut p = PathBuf::from(env!("CARGO_MANIFEST_DIR")); + p.pop(); // rust/ + p.pop(); // repo root + p +} + +fn read_repo(rel: &str) -> String { + std::fs::read_to_string(repo_root().join(rel)) + .unwrap_or_else(|e| panic!("reading {rel}: {e}")) +} + +/// The amino-acid echo transducer the JS test builds inline. +fn aa_echo() -> Value { + let aa = "ACDEFGHIKLMNPQRSTVWY"; + let trans: Vec = aa + .chars() + .map(|c| json!({ "in": c.to_string(), "out": c.to_string(), "to": "S" })) + .collect(); + json!({ "state": [ { "id": "S", "trans": trans } ] }) +} + +const FN3: &str = "t/hmmer/fn3.hmm"; + +// ---------------------------------------------------------------------- +// Parser +// ---------------------------------------------------------------------- + +#[test] +fn parses_fn3_hmmer() { + let model = parse_hmmer(&read_repo(FN3)).unwrap(); + assert_eq!(model.alph.len(), 20, "20-letter amino alphabet"); + assert_eq!(model.alph[0], "A"); + assert!( + model.nodes.len() >= 80 && model.nodes.len() <= 100, + "fn3 K in 80..100 (got {})", + model.nodes.len() + ); + let node = &model.nodes[0]; + assert_eq!(node.match_emit.len(), 20); + assert_eq!(node.ins_emit.len(), 20); + assert!(node.m_to_m >= 0.0 && node.m_to_m <= 1.0); + // Null model = SwissProt background. + assert!((model.null_emit[0] - 0.0825).abs() < 1e-4); +} + +// ---------------------------------------------------------------------- +// fn3 + AA-echo vs boss CLI references +// ---------------------------------------------------------------------- + +/// `boss --hmmer-plan7 fn3.hmm --compose aaecho --output-chars SEQ -L` (single-hit). +const FN3_SH_FORWARD: &[(&str, f64)] = &[ + ("", -15.775871523088234), + ("A", -17.23392012512111), + ("ACDE", -25.700850015908266), + ("VLIWFYH", -35.40283661099204), +]; + +/// `... -V` (single-hit Viterbi). +const FN3_SH_VITERBI: &[(&str, f64)] = &[ + ("A", -20.979034112531608), + ("ACDE", -29.964893469097063), + ("VLIWFYH", -38.86027997772892), +]; + +/// `boss --hmmer-multihit fn3.hmm --compose aaecho --output-chars SEQ -L`. +const FN3_MH_FORWARD: &[(&str, f64)] = &[ + ("ACDE", -26.3939428352782), + ("VLIWFYH", -36.09581217985952), +]; + +/// `... --hmmer-multihit ... -V`. +const FN3_MH_VITERBI: &[(&str, f64)] = &[ + ("ACDE", -30.658040649657007), + ("VLIWFYH", -39.55342715828887), +]; + +fn build_fn3() -> (fused_plan7::PreparedMachine, fused_plan7::HmmerModel) { + let model = parse_hmmer(&read_repo(FN3)).unwrap(); + let td = prepare_machine(&aa_echo(), &HashMap::new()).unwrap(); + (td, model) +} + +#[test] +fn fn3_singlehit_forward_matches_boss() { + let (td, model) = build_fn3(); + let fm = build_fused_plan7(&model, &td, FusedOpts { multihit: false, l: 400.0 }); + for &(seq, expected) in FN3_SH_FORWARD { + let toks = tokenize(seq, &td.output_alphabet).unwrap(); + let got = fused_plan7_forward(&fm, &toks, Semiring::LogSumExp); + // boss does exact silent-cycle elimination; the JS/Rust kernel does a + // 1e-10 fixed-point closure, so allow ~1e-4. (Rust vs JS is < 1e-13.) + assert!( + (got - expected).abs() < 1e-3, + "fn3 SH Forward '{seq}': got {got}, boss {expected}, diff {}", + (got - expected).abs() + ); + } +} + +#[test] +fn fn3_singlehit_viterbi_matches_boss() { + let (td, model) = build_fn3(); + let fm = build_fused_plan7(&model, &td, FusedOpts { multihit: false, l: 400.0 }); + for &(seq, expected) in FN3_SH_VITERBI { + let toks = tokenize(seq, &td.output_alphabet).unwrap(); + let got = fused_plan7_viterbi(&fm, &toks); + assert!( + (got - expected).abs() < 1e-4, + "fn3 SH Viterbi '{seq}': got {got}, boss {expected}, diff {}", + (got - expected).abs() + ); + } +} + +#[test] +fn fn3_multihit_forward_matches_boss() { + let (td, model) = build_fn3(); + let fm = build_fused_plan7(&model, &td, FusedOpts { multihit: true, l: 400.0 }); + for &(seq, expected) in FN3_MH_FORWARD { + let toks = tokenize(seq, &td.output_alphabet).unwrap(); + let got = fused_plan7_forward(&fm, &toks, Semiring::LogSumExp); + assert!( + (got - expected).abs() < 1e-3, + "fn3 MH Forward '{seq}': got {got}, boss {expected}, diff {}", + (got - expected).abs() + ); + } +} + +#[test] +fn fn3_multihit_viterbi_matches_boss() { + let (td, model) = build_fn3(); + let fm = build_fused_plan7(&model, &td, FusedOpts { multihit: true, l: 400.0 }); + for &(seq, expected) in FN3_MH_VITERBI { + let toks = tokenize(seq, &td.output_alphabet).unwrap(); + let got = fused_plan7_viterbi(&fm, &toks); + assert!( + (got - expected).abs() < 1e-4, + "fn3 MH Viterbi '{seq}': got {got}, boss {expected}, diff {}", + (got - expected).abs() + ); + } +} + +// ---------------------------------------------------------------------- +// Structural / semiring properties (mirror the JS test) +// ---------------------------------------------------------------------- + +#[test] +fn forward_finite_and_negative() { + let (td, model) = build_fn3(); + let fm = build_fused_plan7(&model, &td, FusedOpts::default()); + let toks = tokenize("ACDE", &td.output_alphabet).unwrap(); + let f = fused_plan7_forward(&fm, &toks, Semiring::LogSumExp); + assert!(f.is_finite() && f < 0.0, "Forward finite & negative: {f}"); +} + +#[test] +fn viterbi_le_forward_and_strictly_less() { + let (td, model) = build_fn3(); + let fm = build_fused_plan7(&model, &td, FusedOpts::default()); + let toks = tokenize("ACDE", &td.output_alphabet).unwrap(); + let f = fused_plan7_forward(&fm, &toks, Semiring::LogSumExp); + let v = fused_plan7_viterbi(&fm, &toks); + assert!(f.is_finite() && v.is_finite()); + assert!(v <= f + 1e-10, "Viterbi {v} <= Forward {f}"); + // Multiple paths contribute, so Forward strictly exceeds Viterbi. + assert!(f > v + 1e-6, "Forward {f} > Viterbi {v}"); +} + +#[test] +fn empty_sequence_finite() { + let (td, model) = build_fn3(); + let fm = build_fused_plan7(&model, &td, FusedOpts::default()); + let f = fused_plan7_forward(&fm, &[], Semiring::LogSumExp); + assert!(f.is_finite() && f < 0.0, "empty Forward finite & negative: {f}"); +} + +#[test] +fn mismatched_alphabet_gives_neg_inf() { + // fn3 (amino) composed with a 0/1 bit-echo: no amino input matches 0/1, so + // no valid path -> -inf (mirrors the JS bitecho test). + let model = parse_hmmer(&read_repo(FN3)).unwrap(); + let bitecho = read_repo("t/machine/bitecho.json"); + let bitecho: Value = serde_json::from_str(&bitecho).unwrap(); + let td = prepare_machine(&bitecho, &HashMap::new()).unwrap(); + let fm = build_fused_plan7(&model, &td, FusedOpts::default()); + let toks = tokenize("010101", &td.output_alphabet).unwrap(); + let f = fused_plan7_forward(&fm, &toks, Semiring::LogSumExp); + assert!(f == f64::NEG_INFINITY || f < -1e30, "expected -inf, got {f}"); +} + +// ---------------------------------------------------------------------- +// Cabinet: PF03184 + prot2dna vs the JS CPU reference (the oracle for this +// multi-state-transducer case). Skipped if the external data is absent. +// ---------------------------------------------------------------------- + +const CABINET: &str = + "/Users/yam/Dropbox/Classes/BioE131/AgentUpdate2026/games/cabinet/validator-rs/data"; + +/// Codon (E.coli) + flank params + uniform DNA background, matching the params +/// used to capture the JS reference values below. +fn prot2dna_params() -> HashMap { + let mut p: HashMap = + serde_json::from_str(&std::fs::read_to_string(repo_root().join("data/Ecoli_codon.json")).unwrap()) + .unwrap(); + // flank_introns.json: { flankExtend, intron, extendIntron } + let flank: HashMap = serde_json::from_str( + &std::fs::read_to_string(repo_root().join("data/flank_introns.json")).unwrap(), + ) + .unwrap(); + for (k, v) in flank { + p.insert(k, v); + } + for b in ["pA", "pC", "pG", "pT"] { + p.insert(b.to_string(), 0.25); + } + p +} + +/// (seq, multihit, JS Forward, JS Viterbi) captured from node on +/// js/webgpu/cpu/fused-plan7.mjs with the params above. +const PF03184_PROT2DNA: &[(&str, bool, f64, f64)] = &[ + ("", false, -19.554530337765993, -30.834164134850855), + ("ATG", false, -21.194599680482842, -32.50226678012371), + ("ATGGCAGATGAA", false, -24.004941621751914, -39.78891199458879), + ("GCAGATGAATTT", false, -24.21970905774714, -41.63739089276443), + ("ATGGCAGATGAATTTCATCAT", false, -28.582169471906212, -52.37848618913655), + ("", true, -20.24767751832594, -31.5273113154108), + ("ATGGCAGATGAA", true, -24.69753894443723, -40.482059175148734), + ("GCAGATGAATTT", true, -24.912316659780043, -42.33053807332438), +]; + +#[test] +fn pf03184_prot2dna_matches_js_reference() { + let cab = PathBuf::from(CABINET); + if !cab.join("PF03184.hmm").exists() || !cab.join("prot2dna.json").exists() { + eprintln!("skipping: Cabinet data not present at {CABINET}"); + return; + } + let model = parse_hmmer(&std::fs::read_to_string(cab.join("PF03184.hmm")).unwrap()).unwrap(); + let machine: Value = + serde_json::from_str(&std::fs::read_to_string(cab.join("prot2dna.json")).unwrap()).unwrap(); + let params = prot2dna_params(); + let td = prepare_machine(&machine, ¶ms).unwrap(); + assert_eq!(td.n_states, 132, "prot2dna has 132 states"); + + for &(seq, mh, jf, jv) in PF03184_PROT2DNA { + let fm = build_fused_plan7(&model, &td, FusedOpts { multihit: mh, l: 400.0 }); + let toks = if seq.is_empty() { + Vec::new() + } else { + tokenize(seq, &td.output_alphabet).unwrap() + }; + let f = fused_plan7_forward(&fm, &toks, Semiring::LogSumExp); + let v = fused_plan7_viterbi(&fm, &toks); + // Same f64 algorithm as the JS -> last-ULP agreement. + assert!( + (f - jf).abs() < 1e-9, + "PF03184 prot2dna Forward '{seq}' mh={mh}: Rust {f}, JS {jf}, diff {}", + (f - jf).abs() + ); + assert!( + (v - jv).abs() < 1e-9, + "PF03184 prot2dna Viterbi '{seq}' mh={mh}: Rust {v}, JS {jv}, diff {}", + (v - jv).abs() + ); + assert!(v <= f + 1e-9, "Viterbi {v} <= Forward {f}"); + } +} + +// ---------------------------------------------------------------------- +// Edge cases +// ---------------------------------------------------------------------- + +#[test] +fn longer_expected_length_lowers_forward() { + // Larger expected length L shifts the N/C loop weights; the kernel should + // remain finite and monotone-ish. Mostly a smoke test for the L plumbing. + let (td, model) = build_fn3(); + let toks = tokenize("ACDE", &td.output_alphabet).unwrap(); + let f10 = { + let fm = build_fused_plan7(&model, &td, FusedOpts { multihit: false, l: 10.0 }); + fused_plan7_forward(&fm, &toks, Semiring::LogSumExp) + }; + let f1000 = { + let fm = build_fused_plan7(&model, &td, FusedOpts { multihit: false, l: 1000.0 }); + fused_plan7_forward(&fm, &toks, Semiring::LogSumExp) + }; + assert!(f10.is_finite() && f1000.is_finite()); + // Matches the JS: L=10 -> -18.78, L=1000 -> -27.53 (longer L => more loop mass spread, lower). + assert!(f1000 < f10, "L=1000 ({f1000}) < L=10 ({f10})"); +} + +#[test] +fn single_state_transducer_is_dense_equivalent() { + // For the 1-state echo, sparse == dense trivially; confirm a known value. + let (td, model) = build_fn3(); + assert_eq!(td.n_states, 1); + let fm = build_fused_plan7(&model, &td, FusedOpts::default()); + let toks = tokenize("ACDE", &td.output_alphabet).unwrap(); + let f = fused_plan7_forward(&fm, &toks, Semiring::LogSumExp); + assert!((f - (-25.70083821454159)).abs() < 1e-9, "got {f}"); +}